Skip to Content
Merck

EMU017691

MISSION® esiRNA

targeting mouse Kif11

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCAAACCAAGACACAGGAACTTGAAACCACTCAGAAACATTTGCAAGAAACAAAATTACAACTGGTTAAAGAGGAATATGTCTCTTCAGCCTTGGAAAGAACCGAGAAGACACTGCATGACACGGCCAGCAAGTTGCTTAACACGGTTAAAGAAACCACCAGGGCTGTATCTGGTCTACATTCTAAACTGGACCGCAAGAGAGCAATCGATGAGCACAACGCTGAAGCTCAGGAGAGCTTTGGCAAAAACCTCAACAGTCTGTTTAATAATATGGAAGAATTGATTAAGGATGGCAGTGCGAAACAAAAGGCCATGCTAGACGTTCATAAGACACTGTTTGGTAACCTGATGTCTTCTAGTGTCTCTGCATTAGACACCATTACCACGACAGCACTTGAATCTCTCGTGTCTATTCCAGAAAATGTGTCCGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Myles Fennell et al.
Assay and drug development technologies, 13(7), 347-355 (2015-08-13)
Uptake of nutrients, such as glucose and amino acids, is critical to support cell growth and is typically mediated by cell surface transporters. An alternative mechanism for the bulk uptake of nutrients from the extracellular space is macropinocytosis, a nonclathrin
Daniel Edinger et al.
Drug delivery and translational research, 4(1), 84-95 (2015-03-20)
Two antitumoral siRNAs (directed against target genes Eg5 and Ran) complexed with one of three sequence-defined cationic oligomers were compared in gene silencing in vitro and antitumoral in vivo efficacy upon intratumoral injection. Two lipo-oligomers (T-shape 49, i-shape 229) and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service