Millipore Sigma Vibrant Logo

70005 T7SelectUP Primer

View Products on Sigmaaldrich.com
70005
Ver precios y disponibilidad

Descripción

Replacement Information

Precios y disponibilidad

Número de referencia DisponiblidadEmbalaje Cant./Env. Precio Cantidad
70005-3
Comprobando disponibilidad...
Disponibilidad a confirmar
Disponibilidad a confirmar
En existencia 
Suspendido
Cantidades limitadas disponibles
Debe confirmarse disponibilidad
    El resto: se avisará
      El resto: se avisará
      Se avisará
      Póngase en contacto con el Servicio de Atención al Cliente
      Contact Customer Service

      Ampolla de plást. 500 pmol
      Recuperando precio...
      No pudo obtenerse el precio
      La cantidad mínima tiene que ser múltiplo de
      Maximum Quantity is
      Al finalizar el pedido Más información
      Ahorró ()
       
      Solicitar precio
      Description
      OverviewT7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors.
      Mr: 6105
      Catalogue Number70005
      Brand Family Novagen®
      References
      Product Information
      Oligo seqence5ʹ - GGAGCTGTCGTATTCCAGTC - 3ʹ
      Quality SegmentMQ100
      Applications
      Biological Information
      Physicochemical Information
      Dimensions
      Materials Information
      Toxicological Information
      Safety Information according to GHS
      Safety Information
      Product Usage Statements
      Storage and Shipping Information
      Ship Code Shipped with Blue Ice or with Dry Ice
      Toxicity Standard Handling
      Storage -20°C
      Avoid freeze/thaw Avoid freeze/thaw
      Do not freeze Ok to freeze
      Packaging Information
      Transport Information
      Supplemental Information
      Specifications
      Global Trade ITEM Number
      Número de referencia GTIN
      70005-3 04055977273847

      Documentation

      T7SelectUP Primer Ficha datos de seguridad (MSDS)

      Título

      Ficha técnica de seguridad del material (MSDS) 

      T7SelectUP Primer Certificados de análisis

      CargoNúmero de lote
      70005

      Citas

      Título
    • Bryan M. Wittmann, Andrea Sherk and Donald P. McDonnell. (2007) Definition of functionally important mechanistic differences among selective estrogen receptor down-regulators. Cancer Research 67, 9549-9560.
    • Jinguo Chen, et al. (2005) Tachyplesin activates the classic complement pathway to kill tumor cells. Cancer Research 65, 4614-4622.
    • Hoyee Leong, et al. (2005) Recruitment of histone deacetylase 4 to the N-terminal region of estrogen receptor alpha. Molecular Endocrinology 19, 2930-2942.
    • Ulrika Karlson, et al. (2002) Rat mast cell protease 4 is a β-chymase with unusually stringent substrate recognition profile. Journal of Biological Chemistry 277, 18579-18585.
    • Productos y aplicaciones relacionados

      Related Products

      Número de referencia Descripción  
      70006 T7SelectDOWN Primer Precios y disponibilidad

      Productos relacionados por: Brand Facete

      Categorías

      Life Science Research > Genomic Analysis > DNA Preparation & Cloning > Primers