Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGGCCAAGATTCCACTGTTGGAGTGCCTAACCAGACATAGTTACAGAGAATGTTTGGGAAGACTGGATTCTTTACCTGAACATGAAGACTCAGAAAAAGCTGAGATGAAAAGATCCACTGAACTGGTGCTCTCTCCTGATATGCCTAGAACAACTAACGAATCTTTGTTAACCTCATTTCCCAAGTCAGTGGAACATGTGTCCCCAGATACCGCAGATGCTGAAAGTGGCAAAGAAATTAGGGAATCTTGTCAAAGTACTGTTCATCAGCAAGATGAAACTACGATTGACACTAAAGATGGTGATCTGCCCTTTTTTAATGTCTCTTTGTTAGACTGGATAAATGTTCAAGATAGACCTAATGATGTGGAATCTTTGGTCAGGAAGTGCTTTGATTCTATGAGCAGGCTTGATCCAAGGATTATTCGACCATTTATAGCAGAATGCCGTCAAACTATTGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ingrid Kjos et al.
EMBO reports, 18(10), 1727-1739 (2017-08-25)
Autophagy (macroautophagy) is a highly conserved eukaryotic degradation pathway in which cytosolic components and organelles are sequestered by specialized autophagic membranes and degraded through the lysosomal system. The autophagic pathway maintains basal cellular homeostasis and helps cells adapt during stress;
Aykut Turan et al.
The Journal of cell biology, 218(2), 508-523 (2018-12-28)
Dendritic cells (DCs) are crucial for the induction of potent antiviral immune responses. In contrast to immature DCs (iDCs), mature DCs (mDCs) are not permissive for infection with herpes simplex virus type 1 (HSV-1). Here, we demonstrate that HSV-1 infection
Eleonora Turco et al.
Molecular cell, 74(2), 330-346 (2019-03-12)
The autophagy cargo receptor p62 facilitates the condensation of misfolded, ubiquitin-positive proteins and their degradation by autophagy, but the molecular mechanism of p62 signaling to the core autophagy machinery is unclear. Here, we show that disordered residues 326-380 of p62