Skip to Content
Merck

EHU063971

MISSION® esiRNA

targeting human CALCR

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCTGCAACTATTTCTGGATGCTCTGTGAAGGGATCTATCTTCATACACTCATTGTCGTGGCTGTGTTTACTGAGAAGCAACGCTTGCGGTGGTATTATCTCTTGGGCTGGGGGTTCCCGCTGGTGCCAACCACTATCCATGCTATTACCAGGGCCGTGTACTTCAATGACAACTGCTGGCTGAGTGTGGAAACCCATTTGCTTTACATAATCCATGGACCTGTCATGGCGGCACTTGTGGTCAATTTCTTCTTTTTGCTCAACATTGTCCGGGTGCTTGTGACCAAAATGAGGGAAACCCATGAGGCGGAATCCCACATGTACCTGAAGGCTGTGAAGGCCACCATGATCCTTGTGCCCCTGCTGGGAATCCAGTTTGTCGTCTTTCCCTGGAGACCTTCCAACAAGATGCTTGGGAAGATATATGATTACGTGATGCACTCTCTGATTCATTTCCAGGGCTTCTTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Barbara Toffoli et al.
Clinical science (London, England : 1979), 134(17), 2337-2352 (2020-08-29)
TNF-related apoptosis-inducing ligand (TRAIL) has attracted attention not only as an anti-cancer agent, but also as a potential treatment for diabetes. Animal studies have shown that TRAIL delivery ameliorated glucose control in type 1 and type 2 diabetes. It is
Ruo Feng et al.
Diagnostic pathology, 10, 149-149 (2015-08-27)
Hepatocellular carcinoma (HCC) is one of the most frequent cancers in the world. Calreticulin(CRT) is aberrantly overexpressed in many human cancer cells. The function of CRT in HCC cells remains unclear. We attempted to investigate the effects and the underlying
Saurabh Vig et al.
Cell cycle (Georgetown, Tex.), 14(14), 2274-2284 (2015-05-07)
Calreticulin (CRT) is an endoplasmic reticulum (ER) resident calcium binding protein that is involved in several cellular activities. Transcriptome analyses in CRT knockdown HepG2 cells revealed 253 altered unique genes and subsequent in silico protein-protein interaction network and MCODE clustering