Skip to Content
Merck

EHU141651

MISSION® esiRNA

targeting human ESR1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Chia-Hsin Su et al.
PloS one, 11(11), e0166090-e0166090 (2016-11-03)
Cytokines are low molecular weight regulatory proteins, or glycoproteins, with both tumor-promoting and inhibitory effects on breast cancer growth. Different cytokines play important roles in breast cancer initiation and progression. Here, we show that of the 39 interleukin (IL) genes
Sarah R Hosford et al.
Molecular oncology, 13(8), 1778-1794 (2019-06-11)
Estrogens have been shown to elicit anticancer effects against estrogen receptor α (ER)-positive breast cancer. We sought to determine the mechanism underlying the therapeutic response. Response to 17β-estradiol was assessed in ER+ breast cancer models with resistance to estrogen deprivation:
Kenji Watanabe et al.
Scientific reports, 8(1), 16000-16000 (2018-10-31)
Breast cancer is the most frequent tumor in women, and in nearly two-thirds of cases, the tumors express estrogen receptor α (ERα, encoded by ESR1). Here, we performed whole-exome sequencing of 16 breast cancer tissues classified according to ESR1 expression