Skip to Content
Merck

EMU060971

MISSION® esiRNA

targeting mouse Tmem132a

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCACCCTCTGGACTGCTAAGTTAGACCGCTTCAAGGGCTCAAAGCACCACACCAGCCTGATCACCTGTCACCGTGCTGGGCCTGCAGGGCCAGATTCCAGCCCCCTTGAACTGTCCGAGTTCCTGTGGGTGGACTTTGCAGTGGAGAACAGCACTGGTGGGGGTGTGGCAGTCACTCGCCCTGTCACGTGGCAGCTGGAGTACCCAGGTCAGGCCCCCGAAGCAGAGAAGGACAAAATGGTGTGGGAGATCCTGGTGTCTGAGCGGGACATCAGAGCCCTCATCCCTCTGGCCAAGGCTGAGGAGCTGGTGAACACGGCTCCATTGACTGGAGTGCCCCAGCGTATTCCGGTGCGGCTCGTCACTGTGGACAGTGGGGGAGCCTTGGAGGAGGTGACAGAGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Deng He et al.
International journal of molecular sciences, 16(7), 16313-16329 (2015-07-21)
The molecular events leading to nephrolithiasis are extremely complex. Previous studies demonstrated that calcium and transforming growth factor-β1 (TGF-β1) may participate in the pathogenesis of stone formation, but the explicit mechanism has not been defined. Using a self-created genetic hypercalciuric
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service