Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAAAGGACGTGATCGTCCAGGACGACGATGTGGACTGCACGCTGGTGGAGAAACGTGTGCTGGCGCTGGGGGGCCGGGGTCCTGGCGGCCGGCCCCACTTCCTCACCCAGCTCCACTCCACCTTCCAGACCCCGGACCGCCTGTATTTCGTGATGGAGTACGTCACCGGGGGAGACTTGATGTACCACATTCAACAGCTGGGCAAGTTTAAGGAGCCCCATGCAGCGTTCTACGCGGCAGAAATCGCTATCGGCCTCTTCTTCCTTCACAATCAGGGCATCATCTACAGGGACCTGAAGCTGGACAATGTGATGCTGGATGCTGAGGGACACATCAAGATCACTGACTTTGGCATGTGTAAGGAGAACGTCTTCCCCGGGACGACAACCCGCACCTTCTGCGGGACCCCGGACTACATAGCCCCGGAGATCATTGCCTACCAGCCCTATGGGAAGTCTGTCGATTGGTGGTCCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sylvain Carras et al.
Journal of leukocyte biology, 99(2), 311-319 (2015-09-04)
M-CSF and G-CSF are instructive cytokines that specifically induce differentiation of bipotent myeloid progenitors into macrophages and granulocytes, respectively. Through morphology and colony assay studies, flow cytometry analysis of specific markers, and expression of myeloid transcription factors, we show here
Juan Carlos Montero et al.
Oncotarget, 7(47), 77937-77949 (2016-10-28)
P-Rex proteins are guanine nucleotide exchange factors (GEFs) that act on the Rho/Rac family of GTP binding proteins. The activity of P-Rex proteins is regulated by several extracellular stimuli. In fact, activation of growth factor receptors has been reported to
Tianchao Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 395-402 (2016-09-27)
Application of general anesthetics may induce neurotoxicity in dorsal root ganglia (DRG) neurons. In this study, we examined the possible protective mechanism and associated signaling pathways of small-molecule glycogen synthase kinase-3 (GSK-3) inhibitor, SB216763, in bupivacaine-injured mouse DRG neurons in