Skip to Content
Merck

EHU031451

MISSION® esiRNA

targeting human BRCA2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGCTGCAACAAAGCAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACATAAAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAACCATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGGCTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAAATTAGACTTAGGAAGGAATGTTCCCAATAGTAGACATAAAAGTCTTCGCACAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGTCCACTTCTAAATTCTTGTCTTAGTGAAAGTCCTGTTGTTCTACAATGTACACATGTAACACCACAAAGAGATAAGTCAGTGGTATGTGGGAGTTTGTTTCATACACCAAAGTTTGTGAAGGGTCGTCAGACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

EHU031451-20UG: + EHU031451-50UG:

jan



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Sukrit Mahajan et al.
The international journal of biochemistry & cell biology, 107, 128-139 (2018-12-28)
Cancer cells exhibit HR defects, increased proliferation and checkpoint aberrations. Tumour suppressor proteins, BRCA2 and p53 counteract such aberrant proliferation by checkpoint regulation. Intriguingly, chemo-resistant cancer cells, exhibiting mutated BRCA2 and p53 protein survive even with increased DNA damage accumulation.
Zihao Pan et al.
Annals of translational medicine, 7(23), 777-777 (2020-02-12)
Colon adenocarcinoma (CA) is the most common one with poor survival in colon cancer. This study aims to investigate the effect of miR-1245a on the process of CA cells and its target gene BRCA2. The expression of CA tissues and
Zdenek Skrott et al.
Oncogene, 38(40), 6711-6722 (2019-08-09)
Aldehyde dehydrogenase (ALDH) is a proposed biomarker and possible target to eradicate cancer stem cells. ALDH inhibition as a treatment approach is supported by anti-cancer effects of the alcohol-abuse drug disulfiram (DSF, Antabuse). Given that metabolic products of DSF, rather