Skip to Content
Merck

EHU086621

MISSION® esiRNA

targeting human TLR4

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACAAAGGTGGGAATGCTTTTTCAGAAGTTGATCTACCAAGCCTTGAGTTTCTAGATCTCAGTAGAAATGGCTTGAGTTTCAAAGGTTGCTGTTCTCAAAGTGATTTTGGGACAACCAGCCTAAAGTATTTAGATCTGAGCTTCAATGGTGTTATTACCATGAGTTCAAACTTCTTGGGCTTAGAACAACTAGAACATCTGGATTTCCAGCATTCCAATTTGAAACAAATGAGTGAGTTTTCAGTATTCCTATCACTCAGAAACCTCATTTACCTTGACATTTCTCATACTCACACCAGAGTTGCTTTCAATGGCATCTTCAATGGCTTGTCCAGTCTCGAAGTCTTGAAAATGGCTGGCAATTCTTTCCAGGAAAACTTCCTTCCAGATATCTTCACAGAGCTGAGAAACTTGACCTTCCTGGACCTCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Daohai Zhang et al.
Kidney & blood pressure research, 42(6), 1205-1215 (2017-12-12)
Hyperphosphatemia is one of the most notable features of chronic kidney disease (CKD). Numerous epidemiological and clinical studies have found that high serum phosphate concentrations are associated with calcification in the coronary arteries. However, the mechanisms underlying the vascular calcification
Rui Guo et al.
Scientific reports, 6, 32447-32447 (2016-09-02)
Acute liver disease is characterized by inflammation, oxidative stress and necrosis, which can greatly influence the long term clinical outcome and lead to liver failure or cancer. Here, we initially demonstrated the beneficial role of caspase-9-dependent autophagy in acute liver
Jing Chang et al.
PloS one, 12(9), e0184770-e0184770 (2017-09-13)
Interleukin 33 (IL-33), an inflammatory and mechanically responsive cytokine, is an important component of a TLR4-dependent innate immune process in mucosal epithelium. Although TLR4 also plays a role in sensing biomechanical stretch, a pathway of stretch-induced TLR4-dependent IL-33 biosynthesis has