description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACCTAATCCATGGGGAGGTCCTGGGGAAGGGCTTCTTTGGGCAGGCTATCAAGGTGACACACAAAGCCACGGGCAAAGTGATGGTCATGAAAGAGTTAATTCGATGTGATGAGGAGACCCAGAAAACTTTTCTGACTGAGGTGAAAGTGATGCGCAGCCTGGACCACCCCAATGTGCTCAAGTTCATTGGTGTGCTGTACAAGGATAAGAAGCTGAACCTCCTGACAGAGTACATTGAGGGGGGCACACTGAAGGACTTTCTGCGCAGTATGGATCCGTTCCCCTGGCAGCAGAAGGTCAGGTTTGCCAAAGGAATCGCCTCCGGAATGGCCTATTTGCACTCTATGTGCATCATCCACCGGGATCTGAACTCGCACAACTGCCTCATCAAGTTGGACAAGACTGTGGTGGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
保管分類
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Wei Wang et al.
International journal of cancer, 144(6), 1345-1355 (2018-07-15)
LIM kinases modulate multiple aspects of cancer development, including cell proliferation and survival. As the mechanisms of LIMK-associated tumorigenesis are still unclear, we analyzed the tumorigenic functions of LIM kinase 2 (LIMK2) in human bladder cancer (BC) and explored whether
Xing Duan et al.
Journal of cellular physiology, 233(8), 6088-6097 (2018-01-11)
LIM kinases (LIMK1/2) are LIM domain-containing serine/threonine/tyrosine kinases that mediate multiple cellular processes in mitosis. In the present study, we explored the functional roles and potential signaling pathway of LIMK1/2 during mouse oocyte meiosis. Disruption of LIMK1/2 activity and expression