Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCTGAAAGTTCTTGGCATTACTGACATGTTTGATTCATCAAAGGCAAATTTTGCAAAAATAACAACAGGGTCAGAAAACCTCCATGTTTCTCATATCTTGCAAAAAGCAAAAATTGAAGTCAGTGAAGATGGAACCAAAGCTTCAGCAGCAACAACTGCAATTCTCATTGCAAGATCATCGCCTCCCTGGTTTATAGTAGACAGACCTTTTCTGTTTTTCATCCGACATAATCCTACAGGTGCTGTGTTATTCATGGGGCAGATAAACAAACCCTGAAGAGTATACAAAAGAAACCATGCAAAGCAACGACTACTTTGCTACGAAGAAAGACTCCTTTCCTGCATCTTTCATAGTTCTGTTAAATATTTTTGTACATCGCTTCTTTTTCAAAACTAGTTCTTAGGAACAGACTCGATGCAAGTGTTTCTGTTCTGGGAGGTATTGGAGGGAAAAAACAAGCAGGATGGCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
En-Dong Zhu et al.
PloS one, 9(8), e106049-e106049 (2014-08-30)
Gastric cancer is one of the most common malignant diseases worldwide. Emerging evidence has shown that microRNAs (miRNAs) are associated with tumor development and progression. Our previous studies have revealed that H. pylori infection was able to induce the altered
Kun Wang et al.
Journal of cancer research and clinical oncology, 141(5), 805-812 (2014-11-02)
Altered expression of serine protease inhibitor peptidase inhibitor clade E member 2 (SERPINE2) associates with human cancer development and progression; thus, this study investigated SERPINE2 expression in gastric cancer tissues for association with clinicopathological and survival data from the patients
Ruozhi Zhao et al.
Journal of leukocyte biology, 95(6), 941-949 (2014-02-06)
Diabetes mellitus accelerates the development of atherosclerotic cardiovascular diseases. Monocyte adhesion is an early cellular event of atherogenesis. Elevated levels of glyLDL were common in diabetic patients. Our previous studies indicated that HSF1 and p22-phox (a subunit of the NOX