Skip to Content
Merck

EHU048531

MISSION® esiRNA

targeting human VAV1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCACATGTTCCTCCTGATCGAGGACCAAGGTGCCCAGGGCTATGAGCTGTTCTTCAAGACAAGAGAATTGAAGAAGAAGTGGATGGAGCAGTTTGAGATGGCCATCTCCAACATCTATCCGGAGAATGCCACCGCCAACGGGCATGACTTCCAGATGTTCTCCTTTGAGGAGACCACATCCTGCAAGGCCTGTCAGATGCTGCTTAGAGGTACCTTCTATCAGGGCTACCGCTGCCATCGGTGCCGGGCATCTGCACACAAGGAGTGTCTGGGGAGGGTCCCTCCATGTGGCCGACATGGGCAAGATTTCCCAGGAACTATGAAGAAGGACAAACTACATCGCAGGGCTCAGGACAAAAAGAGGAATGAGCTGGGTCTGCCCAAGATGGAGGTGTTTCAGGAATACTACGGGCTTCCTCCACCCCCTGGAGCCATTGGACCCTTTCTACGGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Guillaume Gaud et al.
Science signaling, 11(538) (2018-07-12)
The activation of T cells requires the guanine nucleotide exchange factor VAV1. Using mice in which a tag for affinity purification was attached to endogenous VAV1 molecules, we analyzed by quantitative mass spectrometry the signaling complex that assembles around activated
Ying Zhou et al.
Journal of cellular biochemistry, 119(7), 5437-5448 (2018-01-26)
This study aims to explore the effect of miR-330 targeting VAV1 on amyloid β-protein (Aβ) production, oxidative stress (OS), and mitochondrial dysfunction in Alzheimer's disease (AD) mice through the MAPK signaling pathway. Putative targeted gene of miR-330 was performed by
Arathi Nair et al.
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not