Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGCAGTCACAGGCAAATGTCTGAGAACATTAGTGGGACATACAGGTGGAGTATGGTCATCACAAATGAGAGACAACATCATCATTAGTGGATCTACAGATCGGACACTCAAAGTGTGGAATGCAGAGACTGGAGAATGTATACACACCTTATATGGGCATACTTCCACTGTGCGTTGTATGCATCTTCATGAAAAAAGAGTTGTTAGCGGTTCTCGAGATGCCACTCTTAGGGTTTGGGATATTGAGACAGGCCAGTGTTTACATGTTTTGATGGGTCATGTTGCAGCAGTCCGCTGTGTTCAATATGATGGCAGGAGGGTTGTTAGTGGAGCATATGATTTTATGGTAAAGGTGTGGGATCCAGAGACTGAAACCTGTCTACACACGTTGCAGGGGCATACTAAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
F-Box/WD Repeat Domain-Containing 7 Induces Chemotherapy Resistance in Colorectal Cancer Stem Cells.
Shusaku Honma et al.
Cancers, 11(5) (2019-05-10)
Although the cancer stem cell (CSC) concept has provided a reasonable explanation for cancer recurrence following chemotherapy, the relationship between CSCs and chemotherapy resistance has not been thoroughly investigated, especially in solid tumors. We aimed to identify the mechanism underlying
Hui Wang et al.
Cancer cell international, 20, 258-258 (2020-06-25)
Cisplatin is widely used as a first-line treatment for non-small cell lung cancer (NSCLC), but chemoresistance remains a major clinical obstacle for efficient use. As a microRNA, miR-223 was reported to promote the doxorubicin resistance of NSCLC. However, whether miR-223
Veronika Reiterer et al.
The EMBO journal, 36(3), 260-273 (2016-12-23)
The F-box protein FBXW7 is the substrate-recruiting subunit of an SCF ubiquitin ligase and a major tumor-suppressor protein that is altered in several human malignancies. Loss of function of FBXW7 results in the stabilization of numerous proteins that orchestrate cell