Skip to Content
Merck

EMU205881

MISSION® esiRNA

targeting mouse Alox5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAAGGAGTGGACTTTGTTCTGAACTACTCAAAAGCGATGGAGAACCTGTTCATCAACCGCTTCATGCACATGTTCCAGTCTTCCTGGCACGACTTTGCTGACTTTGAGAAAATCTTCGTCAAAATCAGCAACACTATATCTGAGCGAGTCAAGAACCACTGGCAGGAAGACCTCATGTTTGGCTACCAGTTCCTGAATGGCTGCAACCCAGTACTCATCAAGCGCTGCACAGCGTTGCCCCCGAAGCTCCCAGTGACCACAGAGATGGTGGAGTGCAGCCTAGAGCGGCAGCTCAGTTTAGAACAGGAAGTACAGGAAGGGAACATTTTCATCGTTGATTACGAGCTACTGGATGGCATCGATGCTAACAAAACTGACCCCTGTACACACCAGTTCCTGGCTGCCCCCATCTGCCTGCTATATAAGAACCTAGCCAACAAGATTGTTCCCATTGCCATCCAGCTCAACCAAACCCCTGGAGAGAGTAACCCAATCTTCCTCCCTACGGATTCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Olga Scherer et al.
Journal of immunological methods, 422, 118-124 (2015-04-22)
Monocytes are an important constituent of the innate immune system. Therefore, manipulating gene expression of primary human monocytes is a crucial mean to study and characterize the functions of targeted proteins in monocytes. Gene silencing by transfection of cells with
Kristi M Porter et al.
PloS one, 9(6), e98532-e98532 (2014-06-07)
Pulmonary Hypertension (PH) is a progressive disorder characterized by endothelial dysfunction and proliferation. Hypoxia induces PH by increasing vascular remodeling. A potential mediator in hypoxia-induced PH development is arachidonate 5-Lipoxygenase (ALOX5). While ALOX5 metabolites have been shown to promote pulmonary

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service