Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCGGACGGAATTACTCCTTGTCTGTGTACCTGGTGAGGCAGTTGACTGCAGGAACCCTTCTACAAAAACTCAGAGCAAAGGGTATCCGGAACCCAGACCACTCGCGGGCACTGATCAAGGAGAAATTGACTGCTGACCCTGACAGTGAGGTGGCCACTACAAGTCTCCGGGTGTCACTCATGTGCCCGCTAGGGAAGATGCGCCTGACTGTCCCTTGTCGTGCCCTCACCTGCGCCCACCTGCAGAGCTTCGATGCTGCCCTTTATCTACAGATGAATGAGAAGAAGCCTACATGGACATGTCCTGTGTGTGACAAGAAGGCTCCCTATGAATCTCTTATCATTGATGGTTTATTTATGGAGATTCTTAGTTCCTGTTCAGATTGTGATGAGATCCAATTCATGGAAGATGGATCCTGGTGCCCAATGAAACCCAAGAAGGAGGCATCTGAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jeong-Hyeon Ko et al.
Immunopharmacology and immunotoxicology, 38(5), 334-343 (2016-06-22)
Constitutive activation of signal transducer and activator of transcription 3 (STAT3) is frequently observed and closely linked with proliferation, survival, metastasis and angiogenesis of various cancer cells, and thus its inhibition can be considered a potential therapeutic strategy. We found
Jordi Codony-Servat et al.
British journal of cancer, 117(12), 1777-1786 (2017-11-11)
Although chemotherapy is the cornerstone treatment for patients with metastatic colorectal cancer (mCRC), acquired chemoresistance is common and constitutes the main reason for treatment failure. Monoclonal antibodies against insulin-like growth factor-1 receptor (IGF-1R) have been tested in pre-treated mCRC patients
Jeong-Hwan Yoon et al.
Nature communications, 6, 7600-7600 (2015-07-22)
Transforming growth factor-β (TGF-β) and interleukin-6 (IL-6) are the pivotal cytokines to induce IL-17-producing CD4(+) T helper cells (TH17); yet their signalling network remains largely unknown. Here we show that the highly homologous TGF-β receptor-regulated Smads (R-Smads): Smad2 and Smad3