Skip to Content
Merck

EHU061741

MISSION® esiRNA

targeting human BECN1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTGAGAGACTGGATCAGGAGGAAGCTCAGTATCAGAGAGAATACAGTGAATTTAAACGACAGCAGCTGGAGCTGGATGATGAGCTGAAGAGTGTTGAAAACCAGATGCGTTATGCCCAGACGCAGCTGGATAAGCTGAAGAAAACCAACGTCTTTAATGCAACCTTCCACATCTGGCACAGTGGACAGTTTGGCACAATCAATAACTTCAGGCTGGGTCGCCTGCCCAGTGTTCCCGTGGAATGGAATGAGATTAATGCTGCTTGGGGCCAGACTGTGTTGCTGCTCCATGCTCTGGCCAATAAGATGGGTCTGAAATTTCAGAGATACCGACTTGTTCCTTACGGAAACCATTCATATCTGGAGTCTCTGACAGACAAATCTAAGGAGCTGCCGTTATACTGTTCTGGGGGGTTGCGGTTTTTCTGGGACAACAAGTTTGACCATGCAATGGTGGCTTTCCTGGACTGTGTGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BECN1(8678)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Guangmin Xi et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1610-1616 (2016-11-09)
Multidrug resistance (MDR) is a major obstacle for successful chemotherapy treatment. Searching for effective MDR modulators and combining them with anticancer drug therapies has been a promising strategy against clinical MDR. In our previous study, we have found that DHA-E3
Haoran Peng et al.
Viruses, 10(5) (2018-05-16)
Autophagy is a common strategy for cell protection; however, some viruses can in turn adopt cellular autophagy to promote viral replication. Zika virus (ZIKV) is the pathogen that causes Zika viral disease, and it is a mosquito-borne virus. However, its
Jingjing Wu et al.
Journal of cellular and molecular medicine, 22(2), 1190-1201 (2017-10-28)
Long-term peritoneal dialysis is accompanied by functional and histopathological alterations in the peritoneal membrane. In the long process of peritoneal dialysis, high-glucose peritoneal dialysis solution (HGPDS) will aggravate the peritoneal fibrosis, leading to decreased effectiveness of peritoneal dialysis and ultrafiltration