Skip to Content
Merck

EHU084891

MISSION® esiRNA

targeting human SLC8A1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGGCCCTTACCATTATCCGCAGAGGTGGTGATTTGACTAACACTGTGTTTGTTGACTTCAGAACAGAGGATGGCACAGCAAATGCTGGGTCTGATTATGAATTTACTGAAGGAACTGTGGTGTTTAAGCCTGGTGATACCCAGAAGGAAATCAGAGTGGGTATCATAGATGATGATATCTTTGAGGAGGATGAAAATTTCCTTGTGCATCTCAGCAATGTCAAAGTATCTTCTGAAGCTTCAGAAGATGGCATACTGGAAGCCAATCATGTTTCTACACTTGCTTGCCTCGGATCTCCCTCCACTGCCACTGTAACTATTTTTGATGATGACCACGCAGGCATTTTTACTTTTGAGGAACCTGTGACTCATGTGAGTGAGAGCATTGGCATCATGGAGGTGAAAGTATTGAGAACATCTGGAGCTCGAGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Guendalina Bastioli et al.
Cell death & disease, 10(2), 80-80 (2019-01-30)
Progressive accumulation of α-synuclein (α-syn) and exposure to environmental toxins are risk factors that may both concur to Parkinson's disease (PD) pathogenesis. Electrophysiological recordings of field postsynaptic potentials (fEPSPs) and Ca2+ measures in striatal brain slices and differentiated SH-SY5Y cells
Barbora Chovancova et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 763-777 (2017-11-24)
Melatonin is a hormone transferring information about duration of darkness to the organism and is known to modulate several signaling pathways in the cells, e.g. generation of endoplasmic reticulum stress, oxidative status of the cells, etc. Melatonin has been shown
Silvia Piccirillo et al.
Cell death & disease, 9(7), 731-731 (2018-06-30)
In brain ischemia, reduction in oxygen and substrates affects mitochondrial respiratory chain and aerobic metabolism, culminating in ATP production impairment, ionic imbalance, and cell death. The restoration of blood flow and reoxygenation are frequently associated with exacerbation of tissue injury