Skip to Content
Merck

EMU019301

MISSION® esiRNA

targeting mouse Gadd45gip1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting mouse Gadd45gip1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGACCTAGACCAGCAGCAACGAAAGCGCCTAAAGGAAGAAAGACAACGACAGAAGAAGGAGGCACGAATTGCTGCTATGGCCTCTGCTGAAGCCCAGGACTCAGCAGTGTCTGGTGAACCCAGCTCCTGAAAGCTCCCTTCCCAATAAAGCCAGCTGCTGACAACCCATATTCTACACATTCTCCCTCAAGTTGTGACTTCCTGGGTCGCCCGGCTCATTCCCCAACACCTGGGCGGGAGAATCCCTCCACCTGGCTGTGTTCACACCTGGACACTAGGCCATGCCATGAACTGGGGCTTTGGGGAGAGAGAAAGGGGAATGGATGGGCAAATAATGAAGGAGCAGATGGCAGGAGAGGAGGAGGCTTCTGTTTACCAACATTAATCTCCAGTAATTAGCCAATTACCAGGGGGAGTACAGCCAAACAGACTGCATG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shahrooz Vahedi et al.
Oncology reports, 34(1), 43-50 (2015-05-23)
Overexpression and hyperactivation of lymphocyte-specific protein tyrosine kinase (Lck) have been associated with leukemia development. We previously showed that, other than its known function as a cytoplasmic signal transducer, Lck also acts as a nuclear transcription factor in mouse leukemic
Harsha Nagar et al.
PloS one, 9(6), e98670-e98670 (2014-06-07)
Mitochondrial dysfunction has been implicated in the pathophysiology of various cardiovascular diseases. CRIF1 is a protein present in the mitochondria associated with large mitoribosomal subunits, and CRIF1 knockdown induces mitochondrial dysfunction and promotes ROS production. p66shc is a redox enzyme

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service