Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTTGAGGCCTTTCTTACCCAGAAGCAGAAGGTGGGAGAACTGAAGGATGACGACTTTGAGAAGATCAGTGAGCTGGGGGCTGGCAATGGCGGTGTGGTGTTCAAGGTCTCCCACAAGCCTTCTGGCCTGGTCATGGCCAGAAAGCTAATTCATCTGGAGATCAAACCCGCAATCCGGAACCAGATCATAAGGGAGCTGCAGGTTCTGCATGAGTGCAACTCTCCGTACATCGTGGGCTTCTATGGTGCGTTCTACAGCGATGGCGAGATCAGTATCTGCATGGAGCACATGGATGGAGGTTCTCTGGATCAAGTCCTGAAGAAAGCTGGAAGAATTCCTGAACAAATTTTAGGAAAAGTTAGCATTGCTGTAATAAAAGGCCTGACATATCTGAGGGAGAAGCACAAGATCATGCACAGAGATGTCAAGCCCTCCAACAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Weiran Liu et al.
Oncotarget, 8(1), 179-190 (2016-06-23)
As shortened telomeres inhibit tumor formation and prolong life span in a KrasG12D mouse lung cancer model, we investigated the implications of telomerase in Kras-mutant NSCLC. We found that Kras mutations increased TERT (telomerase reverse transcriptase) mRNA expression and telomerase
Ching-Ting Wei et al.
Anticancer research, 39(2), 695-701 (2019-02-04)
Sorafenib is now standard treatment for advanced hepatocellular carcinoma (HCC). However, therapeutic efficacy is not as good as was predicted. Many efforts are being made to improve HCC sensitivity to sorafenib. Our previous study demonstrated that co-treatment with chrysin enhanced
Yiqun Huang et al.
Oncology reports, 41(1), 377-386 (2018-10-27)
MAPK kinase 1 (MEK1) is an upstream protein kinase of extracellular signal regulated kinase (ERK), which activates the ERK/MAPK (mitogen activated protein kinase) pathway. Importantly, bioinformatic analysis has shown that there is a target complementary binding site between miR‑101 and MEK1.