Skip to Content
Merck

EHU035581

MISSION® esiRNA

targeting human HDAC3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCTGACTCTCTGGGCTGTGATCGATTGGGCTGCTTTAACCTCAGCATCCGAGGGCATGGGGAATGCGTTGAATATGTCAAGAGCTTCAATATCCCTCTACTCGTGCTGGGTGGTGGTGGTTATACTGTCCGAAATGTTGCCCGCTGCTGGACATATGAGACATCGCTGCTGGTAGAAGAGGCCATTAGTGAGGAGCTTCCCTATAGTGAATACTTCGAGTACTTTGCCCCAGACTTCACACTTCATCCAGATGTCAGCACCCGCATCGAGAATCAGAACTCACGCCAGTATCTGGACCAGATCCGCCAGACAATCTTTGAAAACCTGAAGATGCTGAACCATGCACCTAGTGTCCAGATTCATGACGTGCCTGCAGACCTCCTGACCTATGACAGGACTGATGAGGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuyao Yin et al.
Cell death & disease, 8(6), e2856-e2856 (2017-06-02)
Histone deacetylase 3 (HDAC3) has an oncogenic role in apoptosis and contributes to the proliferation of cancer cells. MI192 is a novel HDAC3-specific inhibitor that displays antitumor activity in many cancer cell lines. However, the role of HDAC3 and the
Jingzhu Zhang et al.
Frontiers in molecular neuroscience, 10, 395-395 (2017-12-15)
The impairment of amyloid-β (Aβ) clearance in the brain plays a causative role in Alzheimer's disease (AD). Polarity distribution of aquaporin-4 (AQP4) is important to remove Aβ from brain. AQP4 polarity can be influenced by the ratio of two AQP4
A Krell et al.
Neuropathology and applied neurobiology, 45(5), 441-458 (2018-12-15)
Aberrant expression of microRNAs (miRNAs) is frequent in various cancers including gliomas. We aimed to characterize the role of miR-16-5p as a candidate tumour suppressor miRNA in gliomas. Real-time PCR-based approaches were used for miRNA and mRNA expression profiling of
Mohammed Ghiboub et al.
Frontiers in immunology, 11, 550769-550769 (2020-10-31)
Histone deacetylases (HDACs) are a group of enzymes that control histone deacetylation and bear potential to direct expression of large gene sets. We determined the effect of HDAC inhibitors (HDACi) on human monocytes and macrophages, with respect to their polarization
Tomoharu Kuboyama et al.
Scientific reports, 7(1), 8641-8641 (2017-08-19)
Following spinal cord injury (SCI), the innate immune response of microglia and infiltrating macrophages clears up cellular debris and promotes tissue repair, but it also inflicts secondary injury from inflammatory responses. Immunomodulation aimed at maximizing the beneficial effects while minimizing

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service