Saltar al contenido
Merck

EHU048671

MISSION® esiRNA

targeting human CAT

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACATGGTCTGGGACTTCTGGAGCCTACGTCCTGAGTCTCTGCATCAGGTTTCTTTCTTGTTCAGTGATCGGGGGATTCCAGATGGACATCGCCACATGAATGGATATGGATCACATACTTTCAAGCTGGTTAATGCAAATGGGGAGGCAGTTTATTGCAAATTCCATTATAAGACTGACCAGGGCATCAAAAACCTTTCTGTTGAAGATGCGGCGAGACTTTCCCAGGAAGATCCTGACTATGGCATCCGGGATCTTTTTAACGCCATTGCCACAGGAAAGTACCCCTCCTGGACTTTTTACATCCAGGTCATGACATTTAATCAGGCAGAAACTTTTCCATTTAATCCATTCGATCTCACCAAGGTTTGGCCTCACAAGGACTACCCTCTCATCCCAGTTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... CAT(847), CAT(847)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mikko Konki et al.
Scientific reports, 6, 22190-22190 (2016-02-26)
Epigenomic regulation is likely to be important in the maintenance of genomic integrity of human pluripotent stem cells, however, the mechanisms are unknown. We explored the epigenomes and transcriptomes of human pluripotent stem cells before and after spontaneous transformation to
Lilibeth Lanceta et al.
PloS one, 10(8), e0134144-e0134144 (2015-08-14)
Earlier observations indicate that free heme is selectively toxic to cells lacking heme oxygenase-1 (HO-1) but how this enzyme prevents heme toxicity remains unexplained. Here, using A549 (human lung cancer) and immortalized human bronchial epithelial cells incubated with exogenous heme

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico