Saltar al contenido
Merck

EHU051241

MISSION® esiRNA

targeting human HMOX1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGACACCAAGGACCAGAGCCCCTCACGGGCACCAGGGCTTCGCCAGCGGGCCAGCAACAAAGTGCAAGATTCTGCCCCCGTGGAGACTCCCAGAGGGAAGCCCCCACTCAACACCCGCTCCCAGGCTCCGCTTCTCCGATGGGTCCTTACACTCAGCTTTCTGGTGGCGACAGTTGCTGTAGGGCTTTATGCCATGTGAATGCAGGCATGCTGGCTCCCAGGGCCATGAACTTTGTCCGGTGGAAGGCCTTCTTTCTAGAGAGGGAATTCTCTTGGCTGGCTTCCTTACCGTGGGCACTGAAGGCTTTCAGGGCCTCCAGCCCTCTCACTGTGTCCCTCTCTCTGGAAAGGAGGAAGGAGCCTATGGCATCTTCCCCAACGAAAAGCACATCCAGGCAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HMOX1(3162)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qian Han et al.
Journal of cellular and molecular medicine, 22(5), 2717-2726 (2018-03-08)
Obstructive sleep apnoea (OSA) characterized by intermittent hypoxia (IH) is closely associated with cardiovascular diseases. IH confers cardiac injury via accelerating cardiomyocyte apoptosis, whereas the underlying mechanism has remained largely enigmatic. This study aimed to explore the potential mechanisms involved
Hongyan Lu et al.
Frontiers in cell and developmental biology, 8, 584653-584653 (2020-10-27)
We have shown previously that adipose stromal cell (ASC)-derived conditioned media (CM) limited lung injury, endothelial barrier dysfunction, and apoptosis. Here, we used endothelial hyperpermeability and apoptosis assays to investigate how concentration processes affect endothelium-directed bioactivity of ASC-CM and to
Yunjun Xiao et al.
Oxidative medicine and cellular longevity, 2018, 3295807-3295807 (2018-10-18)
Curcumin has several therapeutic properties such as anti-inflammatory effect. Heme oxygenase-1 (HO-1) has been showed to have cytoprotective effects in some pathological conditions. However, the role of HO-1 in anti-inflammatory effect of curcumin is unknown. In this study, we investigate
Fiona C Brownfoot et al.
EBioMedicine, 41, 636-648 (2019-03-03)
Preeclampsia is a major complication of pregnancy with no medical treatment. It is associated with placental oxidative stress, hypoxia and inflammation leading to soluble fms-like tyrosine kinase 1 (sFlt-1) and soluble endoglin (sENG) secretion and reduced placental growth factor (PlGF).
Takeaki Shinjo et al.
PloS one, 13(4), e0196191-e0196191 (2018-04-25)
Oxidative stress contributes to myocardial ischemia-reperfusion injury, which causes cardiomyocyte death and precipitate life-threatening heart failure. Propofol has been proposed to protect cells or tissues against oxidative stress. However, the mechanisms underlying its beneficial effects are not fully elucidated. In

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico