Saltar al contenido
Merck

EHU078751

MISSION® esiRNA

targeting human ERBB2

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATCTGCACCATTGATGTCTACATGATCATGGTCAAATGTTGGATGATTGACTCTGAATGTCGGCCAAGATTCCGGGAGTTGGTGTCTGAATTCTCCCGCATGGCCAGGGACCCCCAGCGCTTTGTGGTCATCCAGAATGAGGACTTGGGCCCAGCCAGTCCCTTGGACAGCACCTTCTACCGCTCACTGCTGGAGGACGATGACATGGGGGACCTGGTGGATGCTGAGGAGTATCTGGTACCCCAGCAGGGCTTCTTCTGTCCAGACCCTGCCCCGGGCGCTGGGGGCATGGTCCACCACAGGCACCGCAGCTCATCTACCAGGAGTGGCGGTGGGGACCTGACACTAGGGCTGGAGCCCTCTGAAGAGGAGGCCCCCAGGTCTCCACTGGCACCCTCCGAAGGGGCTGGCTCCGATGTATTTGATGGTGACCTGGGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tong Shu et al.
Cancer letters, 411, 65-73 (2017-10-11)
Resistance to platinum-based chemotherapy is a major cause of treatment failure in patients with epithelial ovarian cancer and predicts a poor prognosis. Previously, we found that HECTD3 confers cancer cell resistance to apoptosis. However, the significance of HECTD3 expression in
Yiseul Choi et al.
World journal of gastroenterology, 22(41), 9141-9153 (2016-11-30)
To investigated the relationships between HER2, c-Jun N-terminal kinase (JNK) and protein kinase B (AKT) with respect to metastatic potential of HER2-positive gastric cancer (GC) cells. Immunohistochemistry was performed on tissue array slides containing 423 human GC specimens. Using HER2-positve
Zhipeng Li et al.
British journal of cancer, 120(3), 306-316 (2018-12-27)
Epidermal growth factor receptor (EGFR) plays an important role in head and neck squamous cell carcinoma (HNSCC) proliferation and therapy resistance, but the efficacy of targeting of EGFR for therapy has been limited. Here, we explore the molecular link between
Nehal Gupta et al.
Scientific reports, 9(1), 5066-5066 (2019-03-27)
Paclitaxel is a first line chemotherapeutic agent for the patients with metastatic breast cancer. But inherited or acquired resistance to paclitaxel leads to poor response rates in a majority of these patients. To identify mechanisms of paclitaxel resistance, we developed
Tiia Honkanen et al.
International journal of oncology, 51(2), 599-606 (2017-06-29)
We have previously shown that cancer stem-like cells (CSLCs) can mediate therapy resistance in ALK translocated lung cancers. HER2 has been linked to CSLCs in breast cancers and, therefore, we wanted to assess whether HER2 has a role in CSLCs

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico