Saltar al contenido
Merck

EHU080011

MISSION® esiRNA

targeting human ATE1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGTGGCTATGGCTCCTTTCACCAGCAGTACTGGCTTGACGGAAAGATCATTGCTGTGGGGGTGATTGACATCCTCCCAAACTGTGTATCATCTGTGTATTTGTACTACGATCCTGATTATTCGTTTTTGTCTTTGGGCGTCTACTCTGCACTACGAGAAATTGCTTTTACTAGGCAGCTTCATGAGAAAACTTCTCAACTCAGCTATTATTATATGGGTTTCTACATTCATTCATGTCCCAAGATGAAATATAAGGGTCAGTATAGACCTTCTGATTTGCTGTGCCCTGAGACATATGTTTGGGTACCCATTGAGCAATGCCTGCCTTCACTTGAAAACTCCAAGTACTGCCGTTTCAACCAGGACCCAGAAGCAGTGGATGAGGATCGCAGTACGGAACCTGACCGATTGCAGGTGTTTCACAAGAGAGCCATCATGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kanika Singh et al.
Scientific reports, 10(1), 598-598 (2020-01-19)
Myocardial hypertrophy, an inflammatory condition of cardiac muscles is a maladaptive response of the heart to biomechanical stress, hemodynamic or neurohormonal stimuli. Previous studies indicated that knockout of Arginyltransferase (ATE1) gene in mice and embryos leads to contractile dysfunction, defective
Chang Hoon Ji et al.
Molecular cell, 75(5), 1058-1072 (2019-08-04)
The endoplasmic reticulum (ER) is susceptible to wear-and-tear and proteotoxic stress, necessitating its turnover. Here, we show that the N-degron pathway mediates ER-phagy. This autophagic degradation initiates when the transmembrane E3 ligase TRIM13 (also known as RFP2) is ubiquitinated via

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico