Saltar al contenido
Merck

EHU089521

MISSION® esiRNA

targeting human ATM

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCATGTGATTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAGGCCTTCTTGT

Ensembl | human accession no.

ENSG00000149311

NCBI accession no.

NM_138292

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... ATM(472), ATM(472)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
VDV
ACIU
TSU
FPU
VMU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yichong Zhang et al.
Science signaling, 11(538) (2018-07-12)
Mitochondria are integral to cellular energy metabolism and ATP production and are involved in regulating many cellular processes. Mitochondria produce reactive oxygen species (ROS), which not only can damage cellular components but also participate in signal transduction. The kinase ATM
Wioleta Grabowska et al.
Biogerontology, 20(6), 783-798 (2019-08-03)
Curcumin, a phytochemical present in the spice named turmeric, and one of the promising anti-aging factors, is itself able to induce cellular senescence. We have recently shown that cells building the vasculature senesced as a result of curcumin treatment. Curcumin-induced
Vinod Vijay Subhash et al.
Molecular cancer therapeutics, 15(12), 3087-3096 (2016-09-18)
Identification of synthetically lethal cellular targets and synergistic drug combinations is important in cancer chemotherapy as they help to overcome treatment resistance and increase efficacy. The Ataxia Telangiectasia Mutated (ATM) kinase is a nuclear protein that plays a major role
Jung-Hee Lee et al.
Nature communications, 8(1), 903-903 (2017-10-14)
MDC1 plays a critical role in the DNA damage response (DDR) by interacting directly with several factors including γ-H2AX. However, the mechanism by which MDC1 is recruited to damaged sites remains elusive. Here, we show that MDC1 interacts with a
Hongbo Chen et al.
Oncotarget, 7(50), 83241-83257 (2016-11-10)
PICT-1 is an essential ribosome biogenesis factor whose loss induces p53 accumulation and apoptosis. Here, we show that DNA damage changes PICT-1 localization and decreases PICT-1 protein levels via the proteasome pathway. Two important phosphatidylinositol 3-kinase-like kinases (PIKKs), ataxia-telangiectasia mutated
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico