Saltar al contenido
Merck

EMU014751

MISSION® esiRNA

targeting mouse Eif2ak3

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGATCAAATGGAAGCCCTTAATCCATTCTCCTTCTAGGACTCCTGTCTTGGTTGGGTCTGATGAATTTGACAAATGTCTAAGTAATGATAAGTATTCCCACGAAGAATACAGTAATGGTGCACTTTCAATCCTCCAGTATCCATACGATAACGGTTACTATCTGCCATACTACAAGAGAGAAAGGAATAAGCGGAGCACGCAGATCACAGTCAGGTTCCTGGACAGCCCCCACTACAGCAAGAACATCCGCAAGAAGGACCCTATCCTCCTGCTGCACTGGTGGAAGGAGATATTCGGGACGATCCTGCTTTGCATCGTAGCCACGACCTTCATCGTGCGCAGGCTTTTCCATCCTCAGCCCCACAGGCAGCGGAAGGAGTCTGAAACTCAGTGCCAGACTGAAAGTAAATACGACTCCGTGAGTGCC

Ensembl | mouse accession no.

ENSMUSG00000031668

NCBI accession no.

NM_010121

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

mouse ... EIF2AK3(13666), Eif2ak3(13666)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QXU
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yue Wang et al.
Antiviral research, 106, 33-41 (2014-04-01)
The unfolded protein response (UPR) is cyto-protective machinery elicited towards an influx of large amount of protein synthesis in the endoplasmic reticulum (ER). Extensive studies suggest that the UPR can also be activated during virus infection. In the present studies
Genkai Guo et al.
Journal of immunology research, 2015, 183738-183738 (2015-06-20)
Previous studies indicated that bone marrow mesenchymal stem cells (BM-MSCs) from patients with systemic lupus erythematosus (SLE) exhibited the phenomenon of apoptosis. In this study, we aimed to investigate whether apoptosis of BM-MSCs from SLE patients were dysregulated. In this
Fei Sun et al.
Toxicology, 325, 52-66 (2014-08-19)
While it has been well-documented that excessive fluoride exposure caused the skeletal disease and osteoblasts played a critical role in the advanced skeletal fluorosis, the underlying mechanism that mediated these effects remain poorly understood. The present study was undertaken to
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico