Saltar al contenido
Merck

EMU026571

MISSION® esiRNA

targeting mouse Hmox1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTCGAATGAACACTCTGGAGATGACACCTGAGGTCAAGCACAGGGTGACAGAAGAGGCTAAGACCGCCTTCCTGCTCAACATTGAGCTGTTTGAGGAGCTGCAGGTGATGCTGACAGAGGAACACAAAGACCAGAGTCCCTCACAGATGGCGTCACTTCGTCAGAGGCCTGCTAGCCTGGTGCAAGATACTGCCCCTGCAGAGACACCCCGAGGGAAACCCCAGATCAGCACTAGCTCATCCCAGACACCGCTCCTCCAGTGGGTCCTCACTCTCAGCTTCCTGTTGGCAACAGTGGCAGTGGGAATTTATGCCATGTAAATGCAATACTGGCCCCCAGGGGCTGTGAACTCTGTCCAATGTGGCCTTCTCTCTGTAAGGGAGAATCTTGCCTGGCTCTCTTCTCTTGGGCCTCTAAGAAAGCTTTTGGGGTCCCTAGCCCACTCCCTGTGTTTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiao Qiao Wang et al.
Biomedical and environmental sciences : BES, 27(10), 786-793 (2014-10-25)
To assess the effect of atorvastatin on lipopolysaccharide (LPS)-induced TNF-α production in RAW264.7 macrophages. RAW264.7 macrophages were treated in different LPS concentrations or at different time points with or without atorvastatin. TNF-α level in supernatant was measured. Expressions of TNF-α
So Ra Kim et al.
Biochemical pharmacology, 95(4), 279-289 (2015-04-22)
High mobility group box 1 (HMGB1) is now recognized as a late mediator of sepsis. We tested hypothesis that ascorbic acid (AscA) induces heme oxygenase (HO)-1 which inhibits HMGB1 release in lipopolysaccharide (LPS)-stimulated cells and increases survival of septic mice.
Yun-Jeong Choe et al.
International journal of oncology, 44(3), 761-768 (2013-12-25)
A recent study reported that p53 can induce HO-1 by directly binding to the putative p53 responsive element in the HO-1 promoter. In this study, we report that nutlin-3, a small molecule antagonist of HDM2, induces the transcription of HO-1
Lilibeth Lanceta et al.
PloS one, 10(8), e0134144-e0134144 (2015-08-14)
Earlier observations indicate that free heme is selectively toxic to cells lacking heme oxygenase-1 (HO-1) but how this enzyme prevents heme toxicity remains unexplained. Here, using A549 (human lung cancer) and immortalized human bronchial epithelial cells incubated with exogenous heme
Li-Chin Sung et al.
Clinical and experimental pharmacology & physiology, 42(6), 632-639 (2015-05-02)
Lycopene is the most potent active antioxidant among the major carotenoids, and its use has been associated with a reduced risk for cardiovascular disease (CVD). Endothelin-1 (ET-1) is a powerful vasopressor synthesized by endothelial cells and plays a crucial role

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico