Saltar al contenido
Merck

EMU041221

MISSION® esiRNA

targeting mouse Gpr109a

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTTGCTTCTTGTGGGGTCTCACCATCGGCCTGACTGTCCACCTCCTCTATACAAACATGATGACCAAAAATGGCGAGGCATATCTGTGTAGCAGCTTCAGCATCTGTTACAACTTCAGGTGGCACGATGCTATGTTCCTCTTGGAATTCTTCTTGCCCCTGGCCATCATCTTGTTCTGCTCAGGCAGGATCATCTGGAGCCTGAGGCAGAGACAGATGGACAGACATGCCAAGATCAAGAGGGCCATCAACTTCATCATGGTGGTGGCTATTGTATTCATCATTTGCTTCCTACCCAGTGTGGCTGTGCGCATCCGCATCTTCTGGCTTCTCTACAAATATAACGTACGCAACTGTGACATCTACTCCTCGGTGGACCTGGCTTTCTTTACCACCCTTAGCTTTACCTACATGAACAGCATGCTGGACCCTGTGGTCTACTATTTCTCCAGCCCATCTTTCCCCAACTTCTTCTCCACGTGTATCAACCGCTGCCTTCGAAAGAAAACATTGGGTGAACCCGATA

Ensembl | mouse accession no.

ENSMUSG00000045502

NCBI accession no.

NM_030701

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

mouse ... GPR109A(80885), Gpr109a(80885)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JDU
VBS
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Genki Hayashi et al.
Human molecular genetics, 26(15), 2864-2873 (2017-05-02)
The induction of mitochondrial biogenesis could potentially alleviate mitochondrial and muscle disease. We show here that dimethyl fumarate (DMF) dose-dependently induces mitochondrial biogenesis and function dosed to cells in vitro, and also dosed in vivo to mice and humans. The
Banabihari Giri et al.
International journal of molecular sciences, 20(18) (2019-09-22)
In this study, we used macrophage RAW264.7 cells to elucidate the molecular mechanism underlying the anti-inflammatory actions of niacin. Anti-inflammatory actions of niacin and a possible role of its receptor GPR109A have been studied previously. However, the precise molecular mechanism
Samar Rezq et al.
The Journal of pharmacology and experimental therapeutics, 356(2), 456-465 (2015-12-02)
G protein-coupled receptor 109A (GPR109A) activation by its ligand nicotinic acid (NA) in immune cells increases Ca(2+) levels, and Ca(2+) induces glutamate release and oxidative stress in central blood pressure (BP)-regulating nuclei, for example, the rostral ventrolateral medulla (RVLM), leading
Hideo Ohira et al.
Lipids in health and disease, 15(1), 213-213 (2016-12-13)
Interactions between adipocytes and macrophages are associated with metabolic disorders. Production of pro-inflammatory mediators and the release of free fatty acids (FFAs) increase when these cells are co-cultured; butyrate significantly diminishes these effects by suppressing both the macrophage inflammatory and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico