Saltar al contenido
Merck

EMU050341

MISSION® esiRNA

targeting mouse Sesn2

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAGCCTGCAGCCTCACCTATAACACCATCGCCATGCACAGTGGCGTGGACACCTCCATGCTCCGCAGGGCCATCTGGAACTACATCCACTGCGTCTTTGGCATCAGATACGATGACTATGATTACGGCGAGGTAAACCAGCTCCTGGAACGGAACCTCAAAATCTATATCAAGACGGTGGCCTGCTACCCTGAGAAGACGACCCGTAGGATGTACAACCTCTTTTGGAGGCACTTCCGCCACTCAGAGAAGGTTCATGTGAACTTGCTGCTCCTTGAAGCCCGCATGCAAGCGGCCCTGCTCTATGCCCTGCGCGCCATCACCCGCTACATGACCTGACTACCCCGTACGCAGGACCAGCACCAGGAGCAGCTGACCCTGGTCCACCGTCCTCTGTGCAAGGACTTCTGTGTCTGGAGACAGATCTGGGAAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in
Hiroko Hamatani et al.
American journal of physiology. Renal physiology, 307(6), F708-F717 (2014-07-25)
Sestrin 2, initially identified as a p53 target protein, accumulates in cells exposed to stress and inhibits mammalian target of rapamycin (mTOR) signaling. In normal rat kidneys, sestrin 2 was selectively expressed in parietal epithelial cells (PECs), identified by the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico