Saltar al contenido
Merck

EMU079511

MISSION® esiRNA

targeting mouse Atf4

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGATGCTCTGTTTCGAATGGATGACCTGGAAACCATGCCAGATGAGCTCTTGACCACGTTGGATGACACATGTGATCTTTTTGCCCCTCTAGTCCAAGAGACTAATAAGGAGCCCCCTCAGACAGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAATAAAAGTCGACCAGGTTGCCCCCTTTACATTCTTGCAGCCTTTCCCCTGTTCCCCAGGGGTTCTGTCTTCCACTCCAGAGCATTCCTTTAGTTTAGAGCTAGGCAGTGAAGTTGATATCTCTGAAGGAGACAGGAAGCCTGACTCTGCTGCTTACATTACTCTAATCCCTCCATGTGTAAAGGAGGAAGACACTCCCTCTGACAATGACAGTGGCATCTGTATGAGCCCGGAGTCCTACCTGGGCTCTCCCCAGCATAGCCCCTCCACCTCCAGGGCCCCACCAGACAATCTGCCTTCTCCAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hui Zhang et al.
Journal of translational medicine, 13, 178-178 (2015-06-05)
Anti-dsDNA antibodies play an important role in the pathogenesis of lupus nephritis (LN). Endoplasmic reticulum (ER) stress is a physical reaction under stressful condition and can cause inflammation when stimulation is sustained. This study investigated the roles of ER stress
Kyong-Jin Jung et al.
Oncotarget, 6(3), 1556-1568 (2015-01-19)
Carnosic acid is a phenolic diterpene from rosmarinus officinalis, and has multiple functions, such as anti-inflammatory, anti-viral, and anti-tumor activity. In this study, we examined whether carnosic acid could sensitize TRAIL-mediated apoptosis in human renal carcinoma Caki cells. We found
Enni Markkanen et al.
Nucleic acids research, 43(7), 3667-3679 (2015-03-25)
Genetic instability, provoked by exogenous mutagens, is well linked to initiation of cancer. However, even in unstressed cells, DNA undergoes a plethora of spontaneous alterations provoked by its inherent chemical instability and the intracellular milieu. Base excision repair (BER) is
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in
Souvik Dey et al.
The Journal of clinical investigation, 125(7), 2592-2608 (2015-05-27)
The integrated stress response (ISR) is a critical mediator of cancer cell survival, and targeting the ISR inhibits tumor progression. Here, we have shown that activating transcription factor 4 (ATF4), a master transcriptional effector of the ISR, protects transformed cells

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico