Saltar al contenido
Merck

EMU084221

MISSION® esiRNA

targeting mouse Dnm1l

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCAACATCAGAAGCACTCAAGATTTCCAGAGAGGTAGATCCAGATGGGCGCAGAACTCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATGGATGTATTGATGGGAAGGGTTATTCCAGTCAAGCTTGGAATAATTGGAGTAGTTAACAGAAGCCAACTGGATATTAACAATAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCTTTTCTTCAAAAGAAGTACCCATCTCTGGCCAACAGAAATGGAACAAAGTATCTTGCTAGGACCCTGAATAGGTTACTTATGCATCATATCAGAGATTGTTTACCAGAGCTGAAAACAAGAATAAATGTCTTAGCTGCTCGGTATCAGTCTCTTCTAAATAGCTATGGTGAACCGGTGGATGATAAAAGTGCTACTTTACTCCAGCTTATTACCAAATTTGCCACAGAGTATTGTAACACGATTGAAGGAACCGCAAAGTACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bharathi Aravamudan et al.
American journal of physiology. Lung cellular and molecular physiology, 306(9), L840-L854 (2014-03-13)
The balance between mitochondrial fission and fusion is crucial for mitochondria to perform its normal cellular functions. We hypothesized that cigarette smoke (CS) disrupts this balance and enhances mitochondrial dysfunction in the airway. In nonasthmatic human airway smooth muscle (ASM)
Mabel Lum et al.
International journal of medical microbiology : IJMM, 304(5-6), 530-541 (2014-04-24)
Shigella infection in epithelial cells induces cell death which is accompanied by mitochondrial dysfunction. In this study the role of the mitochondrial fission protein, Drp1 during Shigella infection in HeLa cells was examined. Significant lactate dehydrogenase (LDH) release was detected
Jing Zhou et al.
Autophagy, 11(8), 1259-1279 (2015-06-27)
Autophagy inhibition has been widely accepted as a promising therapeutic strategy in cancer, while the lack of effective and specific autophagy inhibitors hinders its application. Here we found that liensinine, a major isoquinoline alkaloid, inhibits late-stage autophagy/mitophagy through blocking autophagosome-lysosome

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico