콘텐츠로 건너뛰기
Merck

EHU008661

MISSION® esiRNA

targeting human GADD45GIP1

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택


제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTAAGCAGTTCGCGCGTTACGGCGCCGCCTCCGGGGTGGTCCCCGGTTCGTTATGGCCGTCGCCGGAGCAGCTGCGGGAGCTGGAGGCCGAAGAACGCGAATGGTACCCGAGCCTGGCGACCATGCAGGAGTCGCTGCGGGTGAAGCAGCTGGCCGAAGAGCAGAAGCGTCGGGAGAGGGAGCAGCACATCGCAGAGTGCATGGCCAAGATGCCACAGATGATTGTGAACTGGCAGCAGCAGCAGCGGGAGAACTGGGAGAAGGCCCAGGCTGACAAGGAGAGGAGGGCCCGACTGCAGGCTGAGGCCCAGGAGCTCCTGGGCTACCAGGTGGACCCAAGGAGTGCCCGCTTCCAGGAGCTGCTCCAGGACCTAGAGAAGAAGGAGCGCAAGCGCCTCAAGGAGGAAAAACAGAAACGGAAGAAGGAGGCGCGAGCTGCTGCATTGGCTGCAGCTGTGGCTCAAGACCCAGCAGCCTCTGGGGCACCCAGCTCCTGAGGCTTTGTCCCTTCCCAATAAAGCCTGCTACCTGGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Harsha Nagar et al.
Antioxidants & redox signaling, 27(4), 234-249 (2017-01-25)
Mitochondrial dysfunction has emerged as a major contributing factor to endothelial dysfunction and vascular disease, but the key mechanisms underlying mitochondrial dysfunction-induced endothelial dysfunction remain to be elucidated. In this study, we aim at determining whether mitochondrial dysfunction in endothelial
Runzhou Zhuang et al.
Oncotarget, 8(55), 94759-94768 (2017-12-08)
CR6-interacting factor 1 (CRIF1) regulates cell cycle progression and the DNA damage response. Here, we show that CRIF1 expression is decreased in hepatocellular carcinoma (HCC) tissues and positively correlates with patients' survival.
Min Joung Lee et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 40(7), 1546-1561 (2020-01-29)
Cerebral endothelial cells (ECs) require junctional proteins to maintain blood-brain barrier (BBB) integrity, restricting toxic substances and controlling peripheral immune cells with a higher concentration of mitochondria than ECs of peripheral capillaries. The mechanism underlying BBB disruption by defective mitochondrial
Shahrooz Vahedi et al.
Oncology reports, 34(1), 43-50 (2015-05-23)
Overexpression and hyperactivation of lymphocyte-specific protein tyrosine kinase (Lck) have been associated with leukemia development. We previously showed that, other than its known function as a cytoplasmic signal transducer, Lck also acts as a nuclear transcription factor in mouse leukemic
Harsha Nagar et al.
PloS one, 9(6), e98670-e98670 (2014-06-07)
Mitochondrial dysfunction has been implicated in the pathophysiology of various cardiovascular diseases. CRIF1 is a protein present in the mitochondria associated with large mitoribosomal subunits, and CRIF1 knockdown induces mitochondrial dysfunction and promotes ROS production. p66shc is a redox enzyme

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.