콘텐츠로 건너뛰기
Merck

EHU012421

MISSION® esiRNA

targeting human RALBP1

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택

제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324

주요 문서

모든 문서 보기
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCGTTTTCCGTGAATGTATAGATTACGTAGAGAAGTATGGCATGAAGTGTGAAGGCATCTACAGAGTATCAGGAATTAAATCAAAGGTGGATGAGCTAAAAGCAGCCTATGACCGGGAGGAGTCTACAAACTTGGAAGACTATGAGCCTAACACTGTAGCCAGTTTGCTGAAGCAGTATTTGCGAGACCTTCCAGAGAATTTGCTTACCAAAGAGCTTATGCCCAGATTTGAAGAGGCTTGTGGGAGGACCACGGAGACTGAGAAAGTGCAGGAATTCCAGCGTTTACTCAAAGAACTGCCAGAATGTAACTATCTTCTGATTTCTTGGCTCATTGTGCACATGGACCATGTCATTGCAAAGGAACTGGAAACAAAAATGAATATACAGAACATTTCTATAGTGCTCAGCCCAACTGTGCAGATCAGCAATCGAGTCCTGTATGTGTTTTTCACACATGTGCAAGAACTCTTTGGAAATGTGGTACTAAAGCAAGTGATGAAACCTCTGCGATGGT

Ensembl | human accession no.

ENSG00000017797

NCBI accession no.

NM_006788

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Qi Wang et al.
Oncology reports, 43(1), 188-200 (2019-11-21)
Mutation of the isocitrate dehydrogenase (IDH) gene is regarded a novel indicator for the prognosis of patients with glioma. However, the role of the IDH1 gene mutations in carcinogenesis and the mechanisms underlying their function in glioblastoma multiforme (GBM) remain
Yoshiko Kaku et al.
Cellular signalling, 27(9), 1713-1719 (2015-05-26)
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI)
W He et al.
Oncogene, 33(23), 3004-3013 (2013-07-09)
Killing cancer cells through the induction of apoptosis is one of the main mechanisms of chemotherapy. However, numerous cancer cells have primary or acquired apoptosis resistance, resulting in chemoresistance. In this study, using a novel chalcone derivative chalcone-24 (Chal-24), we
H Schoeneberger et al.
Oncogene, 34(31), 4032-4043 (2014-11-11)
Evasion of apoptosis in pediatric acute lymphoblastic leukemia (ALL) is linked to aberrant expression of inhibitor of apoptosis (IAP) proteins and dysregulated redox homeostasis, rendering leukemic cells vulnerable to redox-targeting therapies. Here we discover that inhibition of antioxidant defenses via

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.