description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAATCCAGCAGAAGTGGTGAAGCAGCGCTTGCAGATGTACAACTCGCAGCACCGGTCAGCAATCAGCTGCATCCGGACGGTGTGGAGGACCGAGGGGTTGGGGGCCTTCTACCGGAGCTACACCACGCAGCTGACCATGAACATCCCCTTCCAGTCCATCCACTTCATCACCTATGAGTTCCTGCAGGAGCAGGTCAACCCCCACCGGACCTACAACCCGCAGTCCCACATCATCTCAGGCGGGCTGGCCGGGGCCCTCGCCGCGGCCGCCACGACCCCCCTGGACGTCTGTAAGACCCTTCTGAACACTCAGGAGAACGTGGCCCTCTCGCTGGCCAACATCAGCGGCCGGCTGTCGGGTATGGCCAATGCCTTCCGGACGGTGTACCAGCTCAACGGCCCGGCTACTTCAAAGGCATCCAGGC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.