콘텐츠로 건너뛰기
Merck

EHU020001

MISSION® esiRNA

targeting human IRF3

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택

제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324

주요 문서

모든 문서 보기
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCCACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTCCGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCTCACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCAGACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTGGATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTGGCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACTCCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAAGAGTGGGAGTTCGAGGTGACAGCCTTCTACCG

Ensembl | human accession no.

ENSG00000126456

NCBI accession no.

NM_001571

shipped in

ambient

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiao-Hua Wang et al.
The international journal of biochemistry & cell biology, 87, 8-17 (2017-03-25)
Respiratory syncytial virus (RSV) is the leading cause of bronchiolitis in infancy, which is a major risk factor for recurrent wheezing and asthma. Orosomucoid 1-like protein 3 (ORMDL3) has been reported to associate with virus-triggered recurrent wheezing and asthma in
Nanae Harashima et al.
Molecular cancer, 13, 217-217 (2014-09-18)
Synthetic double-stranded RNA poly(I:C) is a useful immune adjuvant and exhibits direct antitumor effects against several types of cancers. In this study, we elucidated the mechanisms underlying the effects induced in poly(I:C)-transfected human renal cell carcinoma (RCC) cells. In contrast
Danielle N Kroetz et al.
PLoS pathogens, 11(12), e1005338-e1005338 (2015-12-29)
Influenza A virus (IAV) is an airborne pathogen that causes significant morbidity and mortality each year. Macrophages (Mϕ) are the first immune population to encounter IAV virions in the lungs and are required to control infection. In the present study
Iris F Ueki et al.
The Journal of experimental medicine, 210(10), 1929-1936 (2013-09-04)
Viruses suppress host responses to increase infection, and understanding these mechanisms has provided insights into cellular signaling and led to novel therapies. Many viruses (e.g., Influenza virus, Rhinovirus [RV], Cytomegalovirus, Epstein-Barr virus, and Hepatitis C virus) activate epithelial epidermal growth
Koji Hirono et al.
Modern rheumatology, 30(6), 1074-1081 (2019-10-19)
Background: Endothelial expression of membrane-bound fractalkine/CX3CL1 (Fkn) reportedly acts as a strong mediator of inflammation. Toll-like receptor 3 (TLR3) axes are thought to play some roles in the development of chronic glomerulonephritis (CGN) including lupus nephritis (LN). However, detailed mechanism
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.