콘텐츠로 건너뛰기
Merck

EHU034971

MISSION® esiRNA

targeting human SERPINE2

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택


제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCTGAAAGTTCTTGGCATTACTGACATGTTTGATTCATCAAAGGCAAATTTTGCAAAAATAACAACAGGGTCAGAAAACCTCCATGTTTCTCATATCTTGCAAAAAGCAAAAATTGAAGTCAGTGAAGATGGAACCAAAGCTTCAGCAGCAACAACTGCAATTCTCATTGCAAGATCATCGCCTCCCTGGTTTATAGTAGACAGACCTTTTCTGTTTTTCATCCGACATAATCCTACAGGTGCTGTGTTATTCATGGGGCAGATAAACAAACCCTGAAGAGTATACAAAAGAAACCATGCAAAGCAACGACTACTTTGCTACGAAGAAAGACTCCTTTCCTGCATCTTTCATAGTTCTGTTAAATATTTTTGTACATCGCTTCTTTTTCAAAACTAGTTCTTAGGAACAGACTCGATGCAAGTGTTTCTGTTCTGGGAGGTATTGGAGGGAAAAAACAAGCAGGATGGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

관련 카테고리

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

En-Dong Zhu et al.
PloS one, 9(8), e106049-e106049 (2014-08-30)
Gastric cancer is one of the most common malignant diseases worldwide. Emerging evidence has shown that microRNAs (miRNAs) are associated with tumor development and progression. Our previous studies have revealed that H. pylori infection was able to induce the altered
Kun Wang et al.
Journal of cancer research and clinical oncology, 141(5), 805-812 (2014-11-02)
Altered expression of serine protease inhibitor peptidase inhibitor clade E member 2 (SERPINE2) associates with human cancer development and progression; thus, this study investigated SERPINE2 expression in gastric cancer tissues for association with clinicopathological and survival data from the patients
Ruozhi Zhao et al.
Journal of leukocyte biology, 95(6), 941-949 (2014-02-06)
Diabetes mellitus accelerates the development of atherosclerotic cardiovascular diseases. Monocyte adhesion is an early cellular event of atherogenesis. Elevated levels of glyLDL were common in diabetic patients. Our previous studies indicated that HSF1 and p22-phox (a subunit of the NOX

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.