콘텐츠로 건너뛰기
Merck

EHU073481

MISSION® esiRNA

targeting human EZH2

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택

제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324

주요 문서

모든 문서 보기
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCATGCAACACCCAACACTTATAAGCGGAAGAACACAGAAACAGCTCTAGACAACAAACCTTGTGGACCACAGTGTTACCAGCATTTGGAGGGAGCAAAGGAGTTTGCTGCTGCTCTCACCGCTGAGCGGATAAAGACCCCACCAAAACGTCCAGGAGGCCGCAGAAGAGGACGGCTTCCCAATAACAGTAGCAGGCCCAGCACCCCCACCATTAATGTGCTGGAATCAAAGGATACAGACAGTGATAGGGAAGCAGGGACTGAAACGGGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAGAAAGATGAAACTTCGAGCTCCTCTGAAGCAAATTCTCGGTGTCAAACACCAATAAAGATGAAGCCAAATATTGAACCTCCTGAGAATGTGGAGTGGAGTGGTGCT

Ensembl | human accession no.

ENSG00000106462

NCBI accession no.

NM_152998

shipped in

ambient

storage temp.

−20°C

관련 카테고리

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jiewei Xu et al.
Pathology, research and practice, 215(6), 152374-152374 (2019-04-07)
EZH2 is a core component of the polycomb repressive complex 2 (PRC2), which catalyzes trimethylation of histone H3 lysine 27 (H3K27me3) and promotes carcinogenesis by epigenetically silencing many tumor suppressor genes. Increased EZH2 expression is a marker of advanced and
Hailong Liu et al.
Molecular cancer research : MCR, 15(9), 1275-1286 (2017-05-26)
Medulloblastoma is the most common malignant brain tumor in children. Although accumulated research has suggested that cancer stem-like cells play a key role in medulloblastoma tumorigenesis, the specific molecular mechanism regarding proliferation remains elusive. Here, we reported more abundant expression
Junchao Xue et al.
Biochimica et biophysica acta, 1863(3), 753-763 (2017-01-08)
Circular RNAs (circRNAs), a class of noncoding RNAs generated from pre-mRNAs, participate in regulation of genes. The mechanism for regulation, however, is unknown. Here, to determine if, in human keratinocyte (HaCaT) cells, circular RNAs are involved in arsenite-induced acceleration of
Maria Angelica Stamato et al.
Oncotarget, 8(63), 106527-106537 (2018-01-02)
Downregulation of tumor suppressor (TS) microRNAs (miRNAs) commonly occurs in human cancer, including multiple myeloma (MM). We previously demonstrated that miR-29b is a relevant TS miRNA, whose expression in MM cells is inhibited by HDAC4-dependent deacetylation. Here, we provide novel
Wenyu Wang et al.
Molecular cancer therapeutics, 17(9), 1973-1983 (2018-06-22)
Despite showing promise against PIK3CA-mutant breast cancers in preclinical studies, PI3K/AKT pathway inhibitors demonstrate limited clinical efficacy as monotherapy. Here, we found that histone H3K27me3 demethylase KDM6B-targeted IGFBP5 expression provides a protective mechanism for PI3K/AKT inhibitor-induced apoptosis in breast cancer
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.