description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTGTCAAACAGAAGGAGTCACAGCTCTTCCTTACTTCTTAATCAAGTATGATGAGAACATGGTGCTGGTTTCCTTGCTTAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACGAAGATAACAATTGGTGTATATGATCCCTGTAACTTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTAGCAGCCCACAGATGGAGTAGCAGTTTCCAGTCTGTTGAAGTTGTTTGCTTCCGTGACCGTACCATGCAGGGGGCGAGAGACGTTGCCCACAGCATCATCTTCGAAGTGAAGCTTCCAGAAATGGCATTTAGCCCAGATTGTCCTAAAGCAGTTGGATGGGAAAAGAACCAGAAAGGAGGCATGGGACCAAGGATGGTGAACCTCAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Zhuhui Qiao et al.
Cell death discovery, 6, 31-31 (2020-05-08)
Autophagy is a process involving the self-digestion of components that participates in anti-oxidative stress responses and protects cells against oxidative damage. However, the role of autophagy in the anti-oxidative stress responses of melanocytes remains unclear. To investigate the role of
Chao Zhang et al.
Journal of experimental & clinical cancer research : CR, 36(1), 162-162 (2017-11-18)
Glioblastoma multiforme (GBM) is characterized by lethal aggressiveness and patients with GBM are in urgent need for new therapeutic avenues to improve quality of life. Current studies on tumor invasion focused on roles of cytokines in tumor microenvironment and numerous
Ben C King et al.
Cell metabolism, 29(1), 202-210 (2018-10-09)
We show here that human pancreatic islets highly express C3, which is both secreted and present in the cytosol. Within isolated human islets, C3 expression correlates with type 2 diabetes (T2D) donor status, HbA1c, and inflammation. Islet C3 expression is
Yongsong Cai et al.
Scientific reports, 6, 37845-37845 (2016-11-30)
Oxymatrine (OMT) is a type of alkaloid extracted from a traditional Chinese medicinal herb, Sophora flavescens. Although the antitumor activities of OMT have been observed in various cancers, there are no reports regarding the effects of OMT on human synovial
Paul Zarogoulidis et al.
Molecular oncology, 10(10), 1516-1531 (2016-10-04)
Chemoresistance is a major challenge in lung cancer treatment. Recent findings have revealed that autophagic mechanism contributes significantly to immunosuppressive related chemoresistance. For that reason, targeting autophagy-related immunosuppression is an important approach to reverse tumor drug resistance. In this study
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.