description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGCCTCATTTGAATGTGTGAATTCAATACAGGCTATGTAAAATTTTTACTAATGTCATTATTTTGAAAAAATAAATTTAAAAATACATTCAAAATTACTATTGTATACAAGCTTAATTGTTAATATTCCCTAAACACAATTTTATGAAGGGAGAAGACATTGGTTTGTTGACAATAACAGTACATCTTTTCAAGTTCTCAGCTATTTCTTCTACCTCTCCCTATCTTACATTTGAGTATGGTAACTTATGTCATCTATGTTGAATGTAAGCTTATAAAGCACAAAGCATACATTTCCTGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Rui Jiang et al.
International immunopharmacology, 69, 373-381 (2019-02-19)
Kaempferol is a kind of bioflavonoid exerts diverse pharmacological activities, including anti-apoptotic and anti-inflammatory activities. Kaempferol has been recognized as an effective agent for alleviating the clinical symptoms of osteoarthritis (OA). This study aimed to provide evidence that Kaempferol has
Yoshihiro Joshua Ono et al.
The Journal of endocrinology, 223(2), 203-216 (2014-09-24)
Dienogest, a synthetic progestin, has been shown to be effective against endometriosis, although it is still unclear as to how it affects the ectopic endometrial cells. Decorin has been shown to be a powerful endogenous tumor repressor acting in a