description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCCTCCTCGGTGACTTATCCTGTGGTCCCCGGCAGCGTGGACGAGTCTCCCAGTGGAGCATTGAACATCGAATGTAGAATCTGCGGGGACAAGGCCTCAGGCTATCATTACGGAGTCCACGCGTGTGAAGGCTGCAAGGGCTTCTTTCGGCGAACGATTCGACTCAAGCTGGTGTATGACAAGTGCGACCGCAGCTGCAAGATCCAGAAAAAGAACAGAAACAAATGCCAGTATTGTCGATTTCACAAGTGCCTTTCTGTCGGGATGTCACACAACGCGATTCGTTTTGGACGAATGCCAAGATCTGAGAAAGCAAAACTGAAAGCAGAAATTCTTACCTGTGAACATGACATAGAAGATTCTGAAACTGCAGATCTCAAATCTCTGGCCAAGAGAATCTACGAGGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
E Di Giacomo et al.
Cell cycle (Georgetown, Tex.), 16(1), 59-72 (2016-11-20)
PPARs are a class of ligand-activated transcription factors belonging to the superfamily of receptors for steroid and thyroid hormones, retinoids and vitamin D that control the expression of a large number of genes involved in lipid and carbohydrate metabolism and
Maja Grabacka et al.
Archives of dermatological research, 309(3), 141-157 (2017-01-14)
Recent studies revealed the cooperation between peroxisome proliferator-activated receptor gamma (PPARγ) and α-MSH signaling, which results in enhanced melanogenesis in melanocytes and melanoma cells. However, the agonists of PPARα, such as fenofibrate, exert depigmenting effect. Therefore, we aimed to check
Tânia Vieira Madureira et al.
Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology, 229, 1-9 (2018-12-12)
The crosstalk between peroxisome proliferator-activated receptor α (PPARα) and estrogenic pathways are shared from fish to humans. Salmonid fish had an additional genome duplication, and two PPARα isoforms (PPARαBa and PPARαBb) were previously identified. Since a negative regulation between estrogen