description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCAACGGCAAGAACGAGTCGGCCCACATCAGCGACGCCGTGGGCGTGGTGGCCCAGGCCGTGCACGAGCTCCTCGAGAAGGAGAACATCACCGACCCGCCGCGGGGCTGCGTGGGCAACACCAACATCTGGAAGACCGGGCCGCTCTTCAAGAGAGTGCTGATGTCTTCCAAGTATGCGGATGGGGTGACTGGTCGCGTGGAGTTCAATGAGGATGGGGACCGGAAGTTCGCCAACTACAGCATCATGAACCTGCAGAACCGCAAGCTGGTGCAAGTGGGCATCTACAATGGCACCCACGTCATCCCTAATGACAGGAAGATCATCTGGCCAGGCGGAGAGACAGAGAAGCCTCGAGGGTACCAGATGTCCACCAGACTGAAGATTGTGACGATCCACCAGGAGCCCTTCGTGTACGTCAAGCCCACGCTGAGTGATGGGACATGCAAGGAGGAGTTCACAGTCAACGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
James I Hearn et al.
Thrombosis and haemostasis, 120(4), 671-686 (2020-04-15)
The release of calcium ions (Ca2+) from the endoplasmic reticulum (ER) and related store-operated calcium entry (SOCE) regulate maturation of normal megakaryocytes. The N-methyl-D-aspartate (NMDA) receptor (NMDAR) provides an additional mechanism for Ca2+ influx in megakaryocytic cells, but its role
Takashi Miyamoto et al.
The Journal of biological chemistry, 291(4), 1719-1734 (2015-11-22)
Diverse lines of evidence suggest that amyloid-β (Aβ) peptides causally contribute to the pathogenesis of Alzheimer disease (AD), the most frequent neurodegenerative disorder. However, the mechanisms by which Aβ impairs neuronal functions remain to be fully elucidated. Previous studies showed
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.