description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACGCAGCCACTTTGACATATGATACTCTCCGGTTTGCTGAATTTGAAGATTTCCCTGAGACCTCAGAGCCTGTTTGGATTCTGGGCAGAAAATACAGCATTTTCACAGAGAAGGACGAAATCTTGTCTGATGTTGCATCCAGACTTTGGTTTACATACAGGAGAAACTTTCCAGCTATTGGGGGAACTGGCCCTACTTCAGACACAGGCTGGGGTTGCATGCTTCGGTGTGGACAGATGATCTTTGCCCAGGCCCTGGTATGCCGGCACTTAGGTCGAGATTGGAGGTGGACTCAGCGGAAGAGGCAGCCTGACAGCTACTTTAATGTCCTCAATGCTTTCCTCGACAGGAAGGACAGCTACTATTCCATCCATCAGATAGCGCAAATGGGAGTTGGCGAAGGCAAGTCTA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
mouse ... ATG4B(66615), Atg4b(66615)
관련 카테고리
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Katharina Rothe et al.
Blood, 123(23), 3622-3634 (2014-04-24)
Previous studies demonstrated that imatinib mesylate (IM) induces autophagy in chronic myeloid leukemia (CML) and that this process is critical to cell survival upon therapy. However, it is not known if the autophagic process differs at basal levels between CML
Pei-Feng Liu et al.
Autophagy, 10(8), 1454-1465 (2014-07-06)
Autophagy is reported to suppress tumor proliferation, whereas deficiency of autophagy is associated with tumorigenesis. ATG4B is a deubiquitin-like protease that plays dual roles in the core machinery of autophagy; however, little is known about the role of ATG4B on
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.