description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGGACCTAGACCAGCAGCAACGAAAGCGCCTAAAGGAAGAAAGACAACGACAGAAGAAGGAGGCACGAATTGCTGCTATGGCCTCTGCTGAAGCCCAGGACTCAGCAGTGTCTGGTGAACCCAGCTCCTGAAAGCTCCCTTCCCAATAAAGCCAGCTGCTGACAACCCATATTCTACACATTCTCCCTCAAGTTGTGACTTCCTGGGTCGCCCGGCTCATTCCCCAACACCTGGGCGGGAGAATCCCTCCACCTGGCTGTGTTCACACCTGGACACTAGGCCATGCCATGAACTGGGGCTTTGGGGAGAGAGAAAGGGGAATGGATGGGCAAATAATGAAGGAGCAGATGGCAGGAGAGGAGGAGGCTTCTGTTTACCAACATTAATCTCCAGTAATTAGCCAATTACCAGGGGGAGTACAGCCAAACAGACTGCATG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... GADD45GIP1(102060), Gadd45gip1(102060)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Shahrooz Vahedi et al.
Oncology reports, 34(1), 43-50 (2015-05-23)
Overexpression and hyperactivation of lymphocyte-specific protein tyrosine kinase (Lck) have been associated with leukemia development. We previously showed that, other than its known function as a cytoplasmic signal transducer, Lck also acts as a nuclear transcription factor in mouse leukemic
Harsha Nagar et al.
PloS one, 9(6), e98670-e98670 (2014-06-07)
Mitochondrial dysfunction has been implicated in the pathophysiology of various cardiovascular diseases. CRIF1 is a protein present in the mitochondria associated with large mitoribosomal subunits, and CRIF1 knockdown induces mitochondrial dysfunction and promotes ROS production. p66shc is a redox enzyme
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.