Quality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTCGAGATGTGTGGTTTGGACGAATTCCAACTTGCTTTACTCTCTATCAGGATGAGATAACTGAAAGAGAAGCAGAACCATACTATTTGCTTTTGCCAAGAGTCAGCTATTTGACGTTGGTAACTGACAAAGTGAAAAAGCACTTTCAGAAGGTTATGAGACAAGAAGATGTTAGTGAGATATGGTTTGAATATGAAGGCACACCCCTGAAATGGCATTATCCAATTGGTTTACTATTTGATCTTCTTGCATCAAGTTCAGCTCTTCCTTGGAACATCACAGTACATTTCAAGAGTTTTCCAGAAAAGGACCTTCTACACTGTCCATCCAAGGATGCGGTTGAGGCTCACTTTATGTCGTGTATGAAAGAAGCTGATGCTTTAAAGCATAAAAGTCAAGTGATCAACGAAATGCAGAAAAAAGACCACAAGCAGCTCTGGATGGGACTGCAGAATGACAGATTTGACCAGTTTTGGGCCATCAACCGGAAACTCATGGAAT
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... ATG5(11793), Atg5(11793)
관련 카테고리
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Zhiqiang Liu et al.
Oncotarget, 6(33), 34329-34341 (2015-10-13)
A major problem in patients with multiple myeloma is chemotherapy resistance, which develops in myeloma cells upon interaction with bone marrow stromal cells. However, few studies have determined the role of bone marrow adipocytes, a major component of stromal cells
Rongsong Li et al.
Antioxidants & redox signaling, 23(15), 1207-1219 (2015-06-30)
Temporal and spatial variations in shear stress are intimately linked with vascular metabolic effects. Autophagy is tightly regulated in intracellular bulk degradation/recycling system for maintaining cellular homeostasis. We postulated that disturbed flow modulates autophagy with an implication in mitochondrial superoxide
Mark Thomas et al.
Frontiers in cell and developmental biology, 8, 565915-565915 (2020-11-13)
Many clinical trials are beginning to assess the effectiveness of compounds known to regulate autophagy in patients receiving anti-cancer chemotherapy. However, autophagy inhibition, through exogenous inhibitors, or activation, through starvation, has revealed conflicting roles in cancer management and chemotherapeutic outcome.
Qun Wu et al.
PloS one, 10(4), e0124524-e0124524 (2015-04-17)
Human rhinovirus (HRV) is the most common cause of acute exacerbations of chronic lung diseases including asthma. Impaired anti-viral IFN-λ1 production and increased HRV replication in human asthmatic airway epithelial cells may be one of the underlying mechanisms leading to
Hongming Pan et al.
Scientific reports, 4, 6683-6683 (2014-10-21)
Autophagy is a critical survival pathway for cancer cells under conditions of stress. Thus, induction of autophagy has emerged as a drug resistance mechanism. This study is to determine whether autophagy is activated by a novel multikinase inhibitor linifanib, thereby
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.