description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCAACTGAGAACCTGGAAGAGACAGACTGGGTGACGTTTGGGGTTATCCTCAGGAAGGTCACTCCACAGAGTGCTACCAGTGGGCAAACGTTTAGCATCTGGAAACTGAACGACCTTCATGACCTGACTCAGTGTGTGTCCTTGTTCTTGTTTGGAGATGTTCACAAAGATCTCTGGAAGACAGAGCAAGGGACCGTCATAGGCTTGCTCAACGCAAACCCCATGAAGCCCAAAGATGGCTTGAAAGAGGTGTGCTTATCTATTGATCATCCTCAAAAAGTCTTAATTATGGGAGAAGCTATGGACCTGGGAGCCTGTAAAGCCAAGAAGAAGAATGGAGAGCCATGTACACAGACAGTTAACTTGCATGACTGTGAATACTGCCAGTATCACATCCAGGCCCAGTACAAG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
mouse ... MCM10(70024), Mcm10(70024)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Bizhan Romani et al.
The Journal of biological chemistry, 290(28), 17380-17389 (2015-06-03)
Human immunodeficiency virus type 1 Vpr is an accessory protein that induces G2/M cell cycle arrest. It is well documented that interaction of Vpr with the Cul4-DDB1[VprBP] E3 ubiquitin ligase is essential for the induction of G2/M arrest. In this
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.