description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAACTTCAGAGACACAGGCAAGAAGAAGACTCAGGAGACTGGTTGTTACTGAAGAGCCCATACCACAAAGAAAGACTACAAGAGTTGTAAGGCAAACCAGAAACACACAGAAAGAGCCCATAAGTGACAATCAAGGTATGGAAGAGTTTAAGGAATCTTCAGTACAGAAACAAGACCCAAGTGTAAGTTTAACTGGCAGGAGGAACCAACCAAGGACAGTTAAGGAGAAAACCCAACCCTTAGAAGAACTCACCAGTTTCCAAGAGGAAACTGCCAAAAGAATATCTTCCAAATCTCCACAACCGGAAGAGAAGGAAACCTTAGCAGGTTTAAAGAGGCAGCTCAGAATACAACTAATCAACGATGGTGTAAAAGAAGAGCCCACAGCACAGAGAAAGCAACCATCCAGGGAAACCAGGAACACACTCAAAGAGCCTGTAGGTGACAGTATAAATGTTGAAGAGGTTAAGAAGTCTACAAAGCAGAAAATTGATCCAGTAGCAAGTGTGC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
mouse ... MKI67(17345), Mki67(17345)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Xu Zhou et al.
Scientific reports, 5, 10071-10071 (2015-05-12)
Cancer neovascularization plays an essential role in the metastasis of larynx carcinoma (LC). However, the underlying molecular mechanisms are not completely understood. Recently, we reported that placental growth factor (PLGF) regulates expression of matrix metalloproteinase 3 (MMP3) through ERK/MAPK signaling
Kanako Tamura et al.
PloS one, 10(5), e0126003-e0126003 (2015-05-06)
Glucagon-like peptide-1 (GLP-1) receptor agonists potentiate glucose-induced insulin secretion. In addition, they have been reported to increase pancreatic beta cell mass in diabetic rodents. However, the precise mode of action of GLP-1 receptor agonists still needs to be elucidated. Here
David W Chapman et al.
EJNMMI research, 4(1), 27-27 (2015-06-28)
The multitargeting tyrosine kinase inhibitor (TKI) sunitinib is currently the first-line drug therapy for metastasizing renal cell carcinoma (RCC). TKIs have profound effects on tumor angiogenesis, leading to modifications of the tumor microenvironment. The goal of this study was to
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.