description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGACAGATCATCAAGTTAGGCCAGCTCATCTATGAACAGTGTGAAAAGATGAAATACTGCCGGAAACAATGCCAGCGTCTAGGAAACCGTGTGCACGGCCTGCTACAGCCTCTCCAGAGACTCCAGGCCCAAGGAAAGAAGAACCTGCCCGATGACATTACTGCTGCCCTGGGCCGTTTTGATGAAGTCCTGAAGGAGGCTAACCAGCAGATAGAAAAGTTCAGCAAGAAGTCCCATATTTGGAAGTTTGTGAGTGTGGGCAATGATAAGATCCTCTTCCATGAAGTGAATGAGAAGCTGAGAGACGTCTGGGAGGAGCTGTTGCTGCTGCTTCAGGTTTATCATTGGAATACCGTTTCAGATGTCAGCCAGCCAGCATCCTGGCAGCAGGAAGATCGACAGGATGCAGAGGAAGACGGAAATGAAAATATGAAAGTTATCCTGATGCAGTTGCAAATTAGCGTGGAAGAAATCAACAAAACCC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
mouse ... MLKL(74568), Mlkl(74568)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Yuichi Miki et al.
Lasers in medical science, 30(6), 1739-1745 (2015-06-26)
Photodynamic therapy (PDT) using photosensitizer induces several types of cell death, such as apoptosis, necrosis, and autophagy, depending on the PDT procedure, photosensitizer type, and cell type. We previously demonstrated that PDT using the photosensitizer talaporfin sodium (mono-L-aspartyl chlorine e6
Kipyegon Kitur et al.
PLoS pathogens, 11(4), e1004820-e1004820 (2015-04-17)
Staphylococcus aureus USA300 strains cause a highly inflammatory necrotizing pneumonia. The virulence of this strain has been attributed to its expression of multiple toxins that have diverse targets including ADAM10, NLRP3 and CD11b. We demonstrate that induction of necroptosis through
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.